opinion was that genes were made of the protein. It was easy to show that different species had different proteins. Proteins contaminated all preparations of DNA, so many scientist’s believed that it was the contaminating proteins in Avery’s experiments that had transferred the genetic information. When in 1944, the quantum physicist Erwin Schrödinger (of whom much more later) published his book, What is Life?, he went along with the prevailing genes as proteins hypothesis.
However, in the early 1950s Alfred Hershey and Martha Chase’s experiments proved that genes were made of DNA. They demonstrated that when a virus infects a bacterial cell, it injects its DNA but not its protein into the host cell. After infection, the bacteria become transformed to make the bacteriophage proteins. So the genes encoding those proteins must have been injected with the bacteriophage DNA. Genes must be made of DNA.
DNA was quickly accepted as the genetic material, but it was unclear how genetic information was stored within it. The overall chemical composition of DNA was already known – it was composed of a simple sugar (deoxyribose), phosphate groups and roughly equal quantities of four types of nucleic acids, each made up of carbon, nitrogen and hydrogen atoms. But the profound problem remained – how do these chemicals store the information for the shape of your nose? This was answered by Watson and Crick’s structure.
THE DOUBLE HELIX
The intertwined DNA molecule has become such a strong cultural icon today that it is hard to realise just how unobvious its structure was in the 1950s. Both laboratories racing for a solution initially got it wrong. Linus Pauling of the California Institute of Technology (CalTech) was perhaps the greatest chemist of the twentieth century. He had already discovered proteins contained helical regions so it was hardly surprising that he proposed a helical structure for DNA. However, he wrongly proposed a triple helical structure.
James Watson was an American scientist who came to Cambridge’s Cavendish Laboratory to learn protein biochemistry. However, his real interest was DNA and at Cambridge he teamed up with the Englishman Francis Crick to solve the structure of that ‘most golden of all molecules’.2 Watson and Crick’s first stab at a structure for DNA was (like Pauling’s) also a triple-stranded helix. The pair rashly invited the UK experts on DNA, Maurice Wilkins and Rosalind Franklin, to the unveiling of their putative structure. Wilkins and Franklin had travelled from King’s College, London to view the new model but felt their trip had been wasted when it took just a few minutes for Franklin to spot crucial flaws in the triple helix. After a hasty, tense lunch, the King’s Group rushed off to catch their train home.
News of this débâcle soon reached Sir Lawrence Bragg, chief of the Cavendish laboratory and Watson and Crick were instructed to turn their attentions to less challenging molecules. The pair decided to continue surreptitiously with their model-building. Their approach used wire models representing the chemical groups to build (quite literally) a structure in three-dimensional space that, they hoped, would represent DNA’s actual structure. But how could they know whether their structure was correct? The key was Rosalind Franklin’s X-ray crystallography data – which was essentially an X-ray of the DNA molecule. The problem, according to Watson, was the difficulty they experienced getting a look at the data over the shoulder of the allegedly overly secretive Franklin. Yet between the lines of Watson’s very readable account, The Double Helix, you can read something of the cultural landscape that forged Franklin’s diffidence. Watson’s describes his female colleague:
‘Though her features were strong, she was not unattractive and might have been quite stunning had she taken even a mild interest in her clothes. This she did not. There was never lipstick to contrast with her straight black hair, while at the age of thirty-one her dresses showed all the imagination of the English blue-stocking adolescents.’
There is unfortunately no record of Franklin’s opinion of the good looks and dress sense of her male colleagues. Some inkling of her likely feelings may be garnered from Watson’s account of a particularly frank exchange of views between himself and ‘Rosy’ which ended with her bearing down upon him with a glint of violent retribution in her eyes. Watson was saved from a justly deserved slap by the entry of Franklin’s colleague, Maurice Wilkins.
With the help of Wilkins (though behind Franklin’s back) Watson and Crick finally managed to get a good look at her latest X-ray pictures of DNA and were quick to recognize the telltale image of a helix. Several days of frantic model-building resulted in their triumphant unveiling of the double helical form of DNA. The first to share in the newly discovered ‘secret of life’ were the regulars of the Eagle, the pub just outside the Cavendish laboratories. But a paper was soon drafted to Nature which ended with the classic understatement: ‘It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.’ According to Crick, their intention was not to be coy but was born of Watson’s fear that he might ‘make an ass of himself by saying too much too soon.
HOW DNA WORKS
The key to Watson and Crick’s structure is the order and pairing of the nucleic acid bases. The backbone of each DNA molecule is a string (polymer) of deoxyribose sugars, linked by phosphate groups. Each sugar has a single base attached that can be one of four bases, guanine (G), cytosine (C), thymine (T) or adenine (A). Running down the length of a single DNA strand you can therefore read a linear sequence of bases, such as ATCCGTACCTGAACATAACCGATT… Codes were not unfamiliar in post-war England, particularly to Crick who during the war had worked as a scientist for the Admiralty. The linear sequence of bases looked like a code: the genetic code. Watson and Crick suggested that the sequence of bases codes for the structure of proteins. By the 1950s it was known that proteins performed nearly all the work of making living cells. In particular, enzymes which make everything else DNA, RNA, fats, sugars, polysaccharides – the complete living cell – are proteins. If DNA encoded the information to make proteins, and proteins made everything else, then the problem of how cells know what to make would be solved.
Over the next decade the code was cracked, confirming that DNA sequences did indeed code for proteins. Proteins are linear polymers of amino acids (another group of simple organic acids). There are twenty common amino acids that go into proteins but only four bases that go into DNA. There cannot therefore be a one-to-one coding between a DNA base and an amino acid. It was not long before experiments performed by Marshal Nirenberg, Gobind Khovana and Severo Ochoa established that a triplet of bases, called a codon, encodes each amino acid. The codon GCC for instance codes for the amino acid alanine, whilst GGC codes for glycine. A protein made of only 1,000 alanine amino acids would have a genetic code consisting of 1,000 codons (3,000 bases); each codon being the sequence GCC, generating a DNA sequence GCC GCC GCC GCC GCC… All natural proteins are far more complex than this and are encoded by a more complex code; but the principle is the same.
This was the answer to one of life’s great puzzles: how biological information is encoded and stored inside living cells. The DNA sequence encodes the sequence of proteins and the proteins make everything else (even DNA itself – a curious example of self-reference which is one of the intriguing features of life). By directing the synthesis of proteins, the DNA molecule is able to orchestrate all the activities of the entire cell – and thus the entire body. This is how a dog cell knows how to make a dog, how an oak cell knows how to make an oak tree or how a human cell knows how to make us. Each cell carries its own DNA molecule within it with a unique sequence of bases, encoding the essential dogginess, oakiness, or humanness of us all.
In their historic paper’s last line, Watson and Crick suggested that DNA’s structure also provided a solution to the other great mystery of life, how biological information is passed on from one generation to the next – or
