Organisms staining dark blue or purple are Gram‐positive (Figure 15.1). Organisms staining pink to red are Gram‐negative (Figure 15.2).
Further Reading
1 Reddy CA, Beveridge TJ, Breznak JA. 2007. Methods for General and Molecular Microbiology, 3rd edn. Washington, DC: ASM Press.
2 Songer J, Post K. 2005. General principles of diagnosis. In: Veterinary Microbiology Bacterial and Fungal Agents of Animal Disease. Amsterdam: Elsevier, pp. 10–20.
16 qPCR Assay for the Diagnosis of Infectious Endometritis
Ryan A. Ferris1 and Patrick M. McCue2
1 Summit, Equine, USA
2 Equine Reproduction Laboratory, Colorado State University, USA
Introduction
Infectious endometritis is a significant cause of reproductive inefficiency in mares. Bacterial endometritis is most commonly caused by Streptococcus equi subspecies zooepidemicus, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae, whereas the most common pathogens of uterine fungal infections are Candida species, Aspergillus species, and Mucor species. Diagnosis of bacterial or fungal endometritis is traditionally based on a combination of reproductive history, clinical signs, physical examination, and results of ultrasound, uterine culture, cytology, and biopsy evaluations.
Unfortunately, standard uterine culture techniques do not always detect bacterial or fungal organisms that are present in a mare with infectious endometritis. Problems include presence of slow growing or fastidious bacterial organisms and the difficulty in culturing anaerobic bacterial organisms. In addition, some fungal organisms are notoriously difficult to grow in culture.
Polymerase chain reaction (PCR) can be used to detect minute quantities of the nucleotide sequence of deoxyribonucleic acid (DNA). DNA contains highly conserved regions that have been maintained throughout phylogenic development (i.e., common throughout the taxonomic kingdom level) and variant regions, which can be used for the identification of genus and species.
Real‐time quantitative PCR (qPCR) assays work through primer probes specific for the conserved region of the 16S or 28S ribosomal DNA (rDNA) sequences for the detection of bacterial or fungal organisms, respectively. qPCR amplifies the target sequence of the rDNA, which is monitored in real time by measurement of increased fluorescence as the amplification process occurs. This allows for a semiquantitative analysis as a high level of fluorescence early in the replication process indicates a greater number of original DNA targets. The final result of the qPCR reaction is millions of copies of an amplicon (i.e., the 16S or 28S rDNA regions that the primers targeted). This initial step allows for the determination of whether bacterial or fungal DNA is present or absent.
A second step involves DNA sequencing of the amplicon, which determines the order of nucleotides (G, A, T, and C) in a segment of DNA. Determination of the nucleotide sequence allows for the identification of the genus and species of bacterial or fungal organisms, as each organism has a genetically different DNA sequence.
Equipment and Supplies
Double‐guarded culture swab or a low volume lavage to collect a uterine sample, sterile container (e.g. 15 ml conical tube or sterile glass tube), diagnostic laboratory.
Sample Collection Technique
Option 1. Collect a swab sample of the endometrium and uterine lumen using traditional techniques (see Chapter 12). The swab tip is placed inside a sterile 15 ml centrifuge tube and submitted for qPCR analysis. The sample should be kept refrigerated or shipped on ice during transport to the laboratory to help maintain DNA integrity. Freezing or excessive heat should be avoided.
Option 2. Collect a low volume uterine lavage sample using traditional techniques (see Chapter 18). Aliquot approximately equal volumes of the recovered effluent fluid into four separate 15 ml centrifuge tubes. The tubes are centrifuged at 600× g for 10 minutes. The supernatant is discarded and the residual pellets remaining at the bottom of the centrifuge tube are submitted for qPCR analysis, traditional microbial culture, and cytologic analysis. The pellet in the last centrifuge tube can be held for later analysis as needed.
qPCR and DNA Sequencing: The Basics
This is a brief explanation of the qPCR process, each laboratory that performs qPCR will have slight modifications designed to optimize laboratory efficiency that are beyond the scope of this chapter.
The ultimate goal of qPCR is to produce a large quantity of a specific genetic sequence that is approximately 100–150 nucleotide bases in length. The nucleotide sequence can then be “decoded” and evaluated against the nucleotide sequence of known microorganisms.
The first step is to extract the DNA from the bacterial or fungal cells. The cells are first lysed to separate the DNA from other cellular material. The DNA is isolated by centrifugation or binding to magnetic beads. The quality and quantity of DNA recovered in the extraction process is imperative to the success of the qPCR assay. DNA extraction that has a low efficiency results in zero or very limited quantities of DNA available for detection by the qPCR assay, leading to the possibility of a false‐negative diagnosis. Commercial kits are available that have been developed to maximize the DNA yield from a wide variety of samples.
The DNA is placed into a special PCR tube.
Primers consisting of short sequences of DNA, 15–30 nucleotides in length, designed to bind to the genetic sequence of interest, are added to the tube. Primers can be designed to detect all known organisms in a kingdom (i.e., the bacterial kingdom or the fungal kingdom). This may be advantageous as it allows detection of all known bacterial or fungal pathogens. However, it requires further diagnostic techniques to identify the specific organism.
Alternatively, primers can be designed that are very specific and will detect a specific genus and species or even a specific gene. The advantage is that no further diagnostics are required. However, other potential pathogens could be missed if their DNA is not detected by a specific PCR assay.
Forward and reverse primers are utilized to detect a small region of DNA. The DNA sequence between the two primers is subsequently replicated. In the case of equine endometritis, the goal is to detect either the 16S rDNA segment of bacteria or the 28S rDNA segment of fungal organisms.Eubacterial primers previously used for the detection of bacterial DNA in equine uterine samples are:forward: 5´‐TCCTACGGGAGGCAGCAGT‐3´reverse: 5´‐GGACTACCAGGGTATCTAATCCTGTT‐3´.Panfungal primers previously used for detection of fungal DNA in equine uterine samples are:forward: 5´‐GCATAT‐CAATAAGCGGAGGAAAAG‐3reverse: 5´‐TTAGCTTTAGATGRARTTTACCACC‐3´.
Nucleotides (A, C, G, T) are added to the PCR tube.
DNA polymerase is added to the tube. The purpose of the DNA polymerase
