G
so the eight possible substituted amino acids are alanine, arginine, aspartate, cysteine, glutamate, serine, tryptophan, and valine.
What other kind of mutation could also arise from a single base substitution of a codon for glycine? The answer is a nonsense mutation since a single base substitution that converts GGA to UGA creates a STOP codon.
SUMMARY
1 DNA, the cell's database, contains the genetic information necessary to encode RNA and protein.
2 The information is stored in the sequence of four bases. These are the purines – guanine and adenine – and the pyrimidines – thymine and cytosine. Each base is attached to the l′‐carbon atom of the sugar deoxyribose. A phosphate group is attached to the 5′‐carbon atom of the sugar. The base + sugar + phosphate is called a nucleotide.
3 The enzyme DNA polymerase joins nucleotides together by forming a phosphodiester bond between the 5′‐phosphate group of one nucleotide and the hydroxyl group on the 3′ carbon of deoxyribose of another. This gives rise to the sugar‐phosphate backbone structure of DNA.
4 The two strands of DNA are held together in an antiparallel double‐helical structure because guanine hydrogen bonds with cytosine and adenine hydrogen bonds with thymine. This means that if the sequence of one strand is known, that of the other can be inferred. The two strands are complementary in sequence.
5 DNA binds to histone and nonhistone proteins to form chromatin. DNA is wrapped around histones to form a nucleosome structure. This is then folded again and again. This packaging compresses the DNA molecule to a size that fits into the cell.
6 The genetic code specifies the sequence of amino acids in a polypeptide. The code is transferred from DNA to mRNA and is read in groups of three bases (a codon) during protein synthesis. There are 64 codons; 61 specify an amino acid and 3 are the stop signals for protein synthesis.
FURTHER READING
1 Annunziato, A.T. (2008). DNA packaging: nucleosomes and chromatin. Nature Education 1 (1): 2008. http://www.nature.com/scitable/topicpage/DNA‐Packaging‐Nucleosomes‐and‐Chromatin‐310.
2 DiGuilo, M. (1997). The origin of the genetic code. Trends in Biochemical Sciences 22: 49–50.
3 Franklin, R.E. and Gosling, R.G. (1953)). Molecular configuration in sodium thymonucleate. Nature 171: 740.
4 Lappalainen, T., Scott, A.J., Brandt, M., and Hall, I.M. (2019). Genomic analysis in the age of human genome sequencing. Cell 177 (1): 70–84. https://doi.org/10.1016/j.cell.2019.02.032.
5 Maddox, B. (2002). Rosalind Franklin: The Dark Lady of DNA. New York: Harper Collins.
6 Ravichandran, S., Subramani, V.K., and Kim, K.K. (2019 Jun). Z‐DNA in the genome: from structure to disease. Biophysical Reviews 11 (3): 383–387. https://doi.org/10.1007/s12551‐019‐00534‐1. Epub 2019 May 22. PMID: 31119604; PMCID: PMC6557933.
7 Sivakumar, A., de Las Heras, J.I., and Schirmer, E.C. (2019). Spatial genome organization: from development to disease. Frontiers in Cell and Development Biology 7: 18. https://doi.org/10.3389/fcell.2019.00018.
8 Travers, A. & Muskhelishvili, G. (2015 Jun). DNA structure and function. The FEBS Journal 282 (12):2279–2295. doi: https://doi.org/10.1111/febs.13307. Epub 2015 Jun 2. PMID: 25903461.
9 Wang, J.C. (2002 Jun). Cellular roles of DNA topoisomerases: a molecular perspective. Nature Reviews. Molecular Cell Biology 3 (6): 430–440. https://doi.org/10.1038/nrm831. PMID: 12042765.
10 Watson, J.D. and Crick, F.H.C. (1953). A structure for deoxyribose nucleic acid. Nature 171: 737.
1 3.1 Theme: Mutationsframeshiftmissensenonsensenone of the aboveConsider the mRNA strand 5′ ACU AUC UGU AUU AUG UUA CAC CCA 3′ coding for the amino acid sequence TICIMLHP. For each of the errors described below, choose the appropriate description from the list above. Refer to Figure 3.9 on page 44 while answering this question.a change of a U to a A in the 6th codon of the sequence, generating the sequence5′ ACUAUCUGUAUUAUGUAACACCCA 3′a change of a U to a C in the 6th codon of the sequence, generating the sequence5′ ACUAUCUGUAUUAUGCUACACCCA 3′a change of a U to a G in the 2nd codon of the sequence, generating the sequence5′ ACUAGCUGUAUUAUGUUACACCCA 3′deletion of a U in the 3rd codon, generating the sequence 5′ ACUAUCUGAUUAUGUUACACCCA 3′deletion of an A in the 4th codon, generating the sequence5′ ACUAUCUGUUUAUGUUACACCCA 3′
2 3.2 Theme: Bases and amino acidsadeninealaninearginineaspartatecytosineglutamateglycineguaninethymineuracilalineFrom the above list of compounds, select the one described by each of the descriptions or questions below.the base that is found in RNA but not in DNAa
